Problem #455

Broken DNA
Public 11/24/17 7xp Programming 66.7%

A DNA molecule is made of 2 strands of nitrogenous bases: A,C,G or T

Each base in the 1st strand is associated with one in the 2nd according the following pairing rules:
- A with T
- C with G

Example:
T G C T A A C C G G
| | | | | | | | | |
A C G A T T G G C C
The 2 strands are separated and broken into fragments of random length:
TGCTAACCGG => TGCT,AACC,GG
ACGATTGGCC => ACGAT,TGG,CC
Then all the fragments are shuffled.
For instance : CC,TGG,GG,TGCT,ACGAT,AACC

You are given the following 65 fragments:
CCGTCCGTTGCCC, TGTCTTGAGCTTCGTGCTGAGCACATGTAATCATAC, TTATT
TGTACAAGCGCGTTTAATGTTATACCAGCATTAATCTACTC
GTGAGTGAATGGGTTATAAACCGGCTGTACGGCTGTTGGGTGTACTGGAGCTACTGCCA
AGATGGTCAACCCTGCCACATCTCCTCAACATC, ACCTCTTCTCGCCTTCACCAGCAAGCATGATT
CGAAGCATTGAACAATTT, ACCGAACGACTGACATACGCTTTTAAATTCTACCAGTTGGGACGGTGTAGAG
ACGTAGGGTATACATTAAACAACCGTTATAGATAT
TTTACACTTCTTGTCTTTCCACCGCAATGTCTGTATTCTAAGACGCA
GGCCGGCTCTAACCTCGAGACCTATAAATCCAAATTGTAGCTTCAAG, CACACT
ACATCTGACAGTGTGGAAAAAGACGTTATGTTAGCGGGGT, GTGAGTAC
ATTTGGATCGCCTGTCGCGTGATTATTAAATCGGGCATAGCTG
CACATTCTTCCAACGCCACAAAATGCTGACTTCTAA, GCCATTTCGCGCCCGGCCGAGATTGGAGCTCTGGATATTT
CGACTCGTGTA, CAATCGCGGATATCTTGAGTATACG, ATTAAGCACCCTCGCTAAGGGCGGAAC
TAACTCGGTGCTTCGTAACTTGTTAAATGGCTTGCTGACTGTATGCGAAAATTTA, CATTAGTATGTGGAGAAGAGC
ATACAGATTTAATAATACGTAGCTAGGGAGCCACTCATGGTGTAAGAAGGTTGCG
AGTTCGCTGCAACTCCGGGCAGAA, GTGTTTTACGACTGAAGATTTGTAGACTGTCACACCTTTTTCTGCAA
AAAGGTGGCGTTACAGACATAAGATTCTGCGTGCAGCAAACAGTAAGTGGAGACTGAG, ATTACGTTAATC, CGCC
CCGACTGGCAGGCAACGGGAAATGTGAAGAACAG, AATAATTTAGCCCGTATCGACCACAGGT, ATCCCTCG
CGCGTGCCTATGCCGACCATATTGCATCCCATATGTAATTTGTTGGCAATATCTATAT
GGGCCTAAACGAGTTCTGTCAAAGGCTCAT, AGGTTTAACATCGA
CACTTACCCAATATTTGGCCGACATGCCGACAACCCACATGACCTCGATG, CCCCGGCGTACAGCTAAAAATAGGCA
CAGGTGTTAGCGCCTATAGAACTCATATGCATTCAAGGAG, GGCT
CGCTTAATCGCCCGGCAGTTATCTTCCGCAGC
CAAGGTCCCGCGAGTAGGCCCGGATTTGCTCAAGACAGTTTCCGAGTAGCAGC, GATAACTCGGTGGCACCA
ACGGTATC, TGGTAACAATGCTGCCAAGAG
GCATCCACTATTCATTGCGGATTAGTGGGTTCCAGGGCGCTCATCC, AGGGCATGTG
CGTCGAATAAACATGTTCGCGCAAATTACAATATGGTCGTAATTAGATGAGATTGAGCCA
GGAAGTGGTCGTTCGTACTAACTATTGAGCCACCGTGGTGCGCACGGATACGGCTGGTATA
CAAAAGAAGTCCTGCACACCGTGTTAAACCTAGCGGACAGCGCACT, AATACCGGGGGAGCCTACGTCT
TAAGTTCCT, GAGTTGTAGTATGTCTAAATTATTATGCATCG
TACAATCGCCCCAGCGAATTAGCGGGCCGTCAATAGAAGGCGTCGGGCTGA
GACTCGTTTTCTTCAGGACGTGTGGCACA
CGACGTTGAGGCCCGTCTTTTATGGCCCCCTCGGATGCAGATAATGCAATTAGGT, GTGTCCACCGA, TAGTC
CGTCGTTTGTCATTCACCTCT, AAATTTTCCCCATCGCGCGTCTGCGTAGGTGATAAGTAACGCCTAATCACC
TTAAAAGGGGTAGCGCGCAGAC, CCGGTAAAGCGCG, ATGTCCA, TTGACCATTGTTACGACGGTTCTCTA
TAATTCGTGGGAGCGATTCC, CCGTACACGGGGCCGCATGTCGATTTTTATCCGTACAGAACTCGAAGCA
Your task is to reconstruct the original DNA molecule from the fragments.

Answer format: The MD5 hash (lowercase hexa) of the comma separated fragments for the 1st strand in alphabetic order (The solution is unique)

Example: cfe6feb5eb9e4d176ac4bdc81b722ede ( MD5 for ACGAT,TGG,CC )

[My timing: instant]



You need to be a member to keep track of your progress.
Register


Time may end, but hope will last forever.

Other Challenge Sites

Contact

elasolova
[64][103][109][97][105][108][46][99][111][109]